-
Notifications
You must be signed in to change notification settings - Fork 1.1k
add anvi-gen-contigs-database module #11713
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
Open
telatin
wants to merge
3
commits into
nf-core:master
Choose a base branch
from
quadram-institute-bioscience:anvi-gen-ctg
base: master
Could not load branches
Branch not found: {{ refName }}
Loading
Could not load tags
Nothing to show
Loading
Are you sure you want to change the base?
Some commits from the old base branch may be removed from the timeline,
and old review comments may become outdated.
Open
Changes from all commits
Commits
Show all changes
3 commits
Select commit
Hold shift + click to select a range
File filter
Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
There are no files selected for viewing
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,7 @@ | ||
| --- | ||
| # yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json | ||
| channels: | ||
| - conda-forge | ||
| - bioconda | ||
| dependencies: | ||
| - bioconda::anvio-minimal=9 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,39 @@ | ||
| process ANVIO_ANVIGENCONTIGSDATABASE { | ||
| tag "${meta.id}" | ||
| label 'process_medium' | ||
|
|
||
| conda "${moduleDir}/environment.yml" | ||
| container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container | ||
| ? 'https://depot.galaxyproject.org/singularity/anvio-minimal:9--pyhdfd78af_0' | ||
| : 'quay.io/biocontainers/anvio-minimal:9--pyhdfd78af_0'}" | ||
|
|
||
| input: | ||
| tuple val(meta), path(fasta), path(external_gene_calls) | ||
|
|
||
| output: | ||
| tuple val(meta), path("*.db"), emit: contigs_db | ||
| tuple val("${task.process}"), val('anvio'), eval("anvi-gen-contigs-database --version 2>&1 | head -n 1 | cut -f 2 -d : | cut -c 2- | sed 's/.*(v//; s/).*//'"), emit: versions_anvio, topic: versions | ||
|
|
||
| when: | ||
| task.ext.when == null || task.ext.when | ||
|
|
||
| script: | ||
| def args = task.ext.args ?: '' | ||
| def prefix = task.ext.prefix ?: "${meta.id}" | ||
| def external_gene_calls_arg = external_gene_calls ? "--external-gene-calls ${external_gene_calls}" : '' | ||
| """ | ||
| anvi-gen-contigs-database \\ | ||
| ${args} \\ | ||
| --num-threads ${task.cpus} \\ | ||
| --contigs-fasta ${fasta} \\ | ||
| --project-name "${prefix}" \\ | ||
| --output-db-path ${prefix}.db \\ | ||
| ${external_gene_calls_arg} | ||
| """ | ||
|
|
||
| stub: | ||
| def prefix = task.ext.prefix ?: "${meta.id}" | ||
| """ | ||
| touch ${prefix}.db | ||
| """ | ||
| } |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,77 @@ | ||
| --- | ||
| # yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json | ||
| name: "anvio_anvigencontigsdatabase" | ||
| description: Generate an anvi'o contigs database from FASTA sequences. | ||
| keywords: | ||
| - anvio | ||
| - contigs | ||
| - database | ||
| - metagenomics | ||
| - fasta | ||
| tools: | ||
| - "anvio": | ||
| description: "Anvi'o is an analysis and visualization platform for 'omics data." | ||
| homepage: "https://merenlab.org/software/anvio/" | ||
| documentation: "https://anvio.org/help/9/programs/anvi-gen-contigs-database/" | ||
| tool_dev_url: "https://github.com/merenlab/anvio" | ||
| doi: "10.1038/s41564-020-00834-3" | ||
| licence: | ||
| - "GPL-3.0-or-later" | ||
| identifier: biotools:anvio | ||
| input: | ||
| - - meta: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing sample information | ||
| e.g. `[ id:'sample1', single_end:false ]` | ||
| - fasta: | ||
| type: file | ||
| description: FASTA file containing contigs or genome sequences. | ||
| pattern: "*.{fa,fasta,fna,fa.gz,fasta.gz,fna.gz}" | ||
| ontologies: | ||
| - edam: http://edamontology.org/format_1929 # FASTA | ||
| - external_gene_calls: | ||
| type: file | ||
| optional: true | ||
| description: Optional TAB-delimited external gene calls file for anvi'o. | ||
| pattern: "*.{txt,tsv}" | ||
| ontologies: | ||
| - edam: http://edamontology.org/format_3475 # TSV | ||
| output: | ||
| contigs_db: | ||
| - - meta: | ||
| type: map | ||
| description: | | ||
| Groovy Map containing sample information | ||
| e.g. `[ id:'sample1', single_end:false ]` | ||
| - "*.db": | ||
| type: file | ||
| description: Anvi'o contigs database. | ||
| pattern: "*.db" | ||
| ontologies: | ||
| - edam: http://edamontology.org/format_3621 # SQLite format | ||
| versions_anvio: | ||
| - - "${task.process}": | ||
| type: string | ||
| description: The name of the process | ||
| - anvio: | ||
| type: string | ||
| description: The name of the tool | ||
| - "anvi-gen-contigs-database --version 2>&1 | head -n 1 | cut -f 2 -d : | cut -c 2- | sed 's/.*(v//; s/).*//'": | ||
| type: eval | ||
| description: The expression to obtain the version of the tool | ||
| topics: | ||
| versions: | ||
| - - "${task.process}": | ||
| type: string | ||
| description: The name of the process | ||
| - anvio: | ||
| type: string | ||
| description: The name of the tool | ||
| - "anvi-gen-contigs-database --version 2>&1 | head -n 1 | cut -f 2 -d : | cut -c 2- | sed 's/.*(v//; s/).*//'": | ||
| type: eval | ||
| description: The expression to obtain the version of the tool | ||
| authors: | ||
| - "@telatin" | ||
| maintainers: | ||
| - "@telatin" |
67 changes: 67 additions & 0 deletions
67
modules/nf-core/anvio/anvigencontigsdatabase/tests/main.nf.test
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,67 @@ | ||
| nextflow_process { | ||
|
|
||
| name "Test Process ANVIO_ANVIGENCONTIGSDATABASE" | ||
| script "../main.nf" | ||
| process "ANVIO_ANVIGENCONTIGSDATABASE" | ||
| config "./nextflow.config" | ||
|
|
||
| tag "modules" | ||
| tag "modules_nfcore" | ||
| tag "anvio" | ||
| tag "anvio/anvigencontigsdatabase" | ||
|
|
||
| test("anvi-gen-contigs-database - synthetic fasta") { | ||
|
|
||
| when { | ||
| process { | ||
| """ | ||
| input[0] = Channel.of( | ||
| ">contig_1", | ||
| "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT", | ||
| "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT", | ||
| ">contig_2", | ||
| "TTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGC", | ||
| "TTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGCTTGCAAGC" | ||
| ) | ||
| .collectFile(name: "contigs.fa", newLine: true, sort: false) | ||
| .map { fasta -> [ [ id:'test' ], fasta, [] ] } | ||
| """ | ||
| } | ||
| } | ||
|
|
||
| then { | ||
| assertAll( | ||
| { assert process.success }, | ||
| { assert process.out.contigs_db.size() == 1 }, | ||
| { assert file(process.out.contigs_db[0][1]).name == "test.db" }, | ||
| { assert file(process.out.contigs_db[0][1]).length() > 0 }, | ||
| { assert snapshot(process.out.versions_anvio).match("versions") } | ||
|
Comment on lines
+35
to
+38
Contributor
There was a problem hiding this comment. Choose a reason for hiding this commentThe reason will be displayed to describe this comment to others. Learn more. Can we have these asswertions be part of the snapshot? |
||
| ) | ||
| } | ||
| } | ||
|
|
||
| test("anvi-gen-contigs-database - stub") { | ||
|
|
||
| options "-stub" | ||
|
|
||
| when { | ||
| process { | ||
| """ | ||
| input[0] = Channel.of( | ||
| ">contig_1", | ||
| "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT" | ||
| ) | ||
| .collectFile(name: "contigs.fa", newLine: true, sort: false) | ||
| .map { fasta -> [ [ id:'test' ], fasta, [] ] } | ||
| """ | ||
| } | ||
| } | ||
|
|
||
| then { | ||
| assertAll( | ||
| { assert process.success }, | ||
| { assert snapshot(process.out).match() } | ||
| ) | ||
| } | ||
| } | ||
| } | ||
59 changes: 59 additions & 0 deletions
59
modules/nf-core/anvio/anvigencontigsdatabase/tests/main.nf.test.snap
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,59 @@ | ||
| { | ||
| "versions": { | ||
| "content": [ | ||
| [ | ||
| [ | ||
| "ANVIO_ANVIGENCONTIGSDATABASE", | ||
| "anvio", | ||
| "9" | ||
| ] | ||
| ] | ||
| ], | ||
| "timestamp": "2026-05-20T10:37:17.429792", | ||
| "meta": { | ||
| "nf-test": "0.9.4", | ||
| "nextflow": "25.10.4" | ||
| } | ||
| }, | ||
| "anvi-gen-contigs-database - stub": { | ||
| "content": [ | ||
| { | ||
| "0": [ | ||
| [ | ||
| { | ||
| "id": "test" | ||
| }, | ||
| "test.db:md5,d41d8cd98f00b204e9800998ecf8427e" | ||
| ] | ||
| ], | ||
| "1": [ | ||
| [ | ||
| "ANVIO_ANVIGENCONTIGSDATABASE", | ||
| "anvio", | ||
| "9" | ||
| ] | ||
| ], | ||
| "contigs_db": [ | ||
| [ | ||
| { | ||
| "id": "test" | ||
| }, | ||
| "test.db:md5,d41d8cd98f00b204e9800998ecf8427e" | ||
| ] | ||
| ], | ||
| "versions_anvio": [ | ||
| [ | ||
| "ANVIO_ANVIGENCONTIGSDATABASE", | ||
| "anvio", | ||
| "9" | ||
| ] | ||
| ] | ||
| } | ||
| ], | ||
| "timestamp": "2026-05-20T10:37:28.314211", | ||
| "meta": { | ||
| "nf-test": "0.9.4", | ||
| "nextflow": "25.10.4" | ||
| } | ||
| } | ||
| } |
5 changes: 5 additions & 0 deletions
5
modules/nf-core/anvio/anvigencontigsdatabase/tests/nextflow.config
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,5 @@ | ||
| process { | ||
| withName: 'ANVIO_ANVIGENCONTIGSDATABASE' { | ||
| ext.args = '--skip-gene-calling' | ||
| } | ||
| } |
Oops, something went wrong.
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
You can run
on this file to clean this up nicely.